Skip to main content
Download PDF

Inhibition of DLK1 regulates AT2 differentiation and alleviates established pulmonary fibrosis by upregulating TTF-1/CLDN6

Respiratory Research volume 26, Article number: 188 (2025) Cite this article

Abstract

Background

Idiopathic pulmonary fibrosis (IPF) is a devastating age-related disease with unknown causes and limited effective treatment. Dysregulation of Alveolar Type 2 (AT2) cells facilitates the initiation of IPF. While differentiation of AT2 into AT1 is necessary for restoring alveolar epithelium. Delta-like non-canonical Notch ligand 1 (DLK1) is a paternally imprinted gene that controls stem cell differentiation. However, the role of DLK1 on AT2 during lung fibrosis remains unclear.

Methods

Lung specimens from 11 patients with IPF or contemporaneous non-IPF controls were collected to determine DLK1 expression. The murine model of bleomycin (BLM) -induced pulmonary fibrosis and cell models of transforming growth factor-beta (TGF-β)-treated A549, MRC5 or primary lung fibroblasts (PLFs) were established. Epithelial DLK1 knockdown mice were constructed by an alveolar epithelial -specific adeno-associated virus (AAV) 6 vector system. Besides, primary AT2 cells were isolated from SPC-EGFP mice and cultured in 2D and 3D organoids.

Results

In the present study, we found that DLK1, predominantly expressed in AT2 cells, was upregulated in both IPF lungs and the murine fibrotic lung induced by BLM. AAV-mediated epithelial-specific knockdown of DLK1 promoted the proliferation and differentiation of AT2 into AT1 and alleviated the established lung fibrosis in murine BLM-induced models. In addition, recombinant DLK1 inhibited the renewal of AT2 and aggravated TGF-β-induced fibrosis in vitro, which can be rescued by si-DLK1 intervention. Mechanically, conditional knockdown of DLK1 upregulated TTF-1, a transcriptional factor that controls AT2 differentiation via CLDN6.

Conclusion

DLK1 inhibition regulates AT2 differentiation and contributes to the mitigation of established fibrosis via TTF-1/CLDN6 pathway, which suggests that DLK1 may be a therapeutic target for IPF.

Graphical Abstract

Introduction

Idiopathic pulmonary fibrosis (IPF) is a fatal interstitial lung disease with unknown causes, and only 2–4 years median survival time from diagnosis [1, 2]. IPF begins with repetitive epithelial injuries that destroy the integrity of the epithelial barrier and increase vascular permeability, and finally, leads to pulmonary fibrosis. Previous study demonstrated that abnormally activated Alveolar Epithelial Cells (AECs) act as a vital initiating factor in the development of IPF. These cells interact with immune cells, mesenchymal, and endothelial cells, contributing to the activation of fibroblasts and myofibroblasts, which propagates a profibrotic phenotype [3].

AECs consist of Alveolar Type 1 (AT1) and Alveolar Type 2 (AT2) cells. AT1 cells make up about 95% of the surface and facilitate oxygen exchange, while AT2 cells serve as facultative stem cells capable of renewing and differentiating into AT1 during injury [4, 5]. IPF patients suffer a severe loss of type I pneumocytes, and the differentiation of AT2 into AT1 is necessary for restoring the structure of the alveolar epithelium [6]. However, the regulatory mechanism of this differentiation during lung fibrosis remains undetermined.

Delta-like non-canonical Notch ligand 1 (DLK1), also known as Preadipocyte factor-1 (Pref-1), is a single-pass transmembrane protein belonging to the Notch/Delta/Serrate family. As a paternally imprinted gene, DLK1 is expressed in fetal tissues and remains absent postnatally but increases during tissue repair [7, 8]. Finn et al. demonstrated that following alveolar injury, DLK1 precisely regulates the inhibition of Notch signaling, triggering AT2-to-AT1 differentiation and promoting alveolar repair [9].

Recent studies showed that DLK1 strongly influences stem cell differentiation and cancer stemness [7, 9, 10]. Other studies revealed that DLK1 can exacerbate liver fibrosis by upregulating hepatic stellate cell activation [11,12,13] while alleviate myocardial fibrosis by regulating fibroblast activation and extracellular matrix deposition. Deletion of DLK1 accelerates fibroblast-to-myofibroblast differentiation, promoting cardiac fibrosis after myocardial injury [14]. In contrast, DLK1 overexpression alleviates sepsis-induced cardiac dysfunction and fibrosis by suppressing the TGF-β1/Smad3 signaling pathway and modulating MMPs [15]. Additionally, DLK1 contributes to fibrosis through epithelial-to-mesenchymal transition (EMT), particularly via its pericardial expression [16]. These findings highlight DLK1 as a critical regulator of myocardial fibrosis and a potential therapeutic target for cardiac injury. For respiratory diseases, an in vitro study using fibroblasts from patients with chronic obstructive asthma demonstrated that DLK1 aggravated the airway fibrosis of COPD via inducing lung fibroblast differentiation [17].

Despite growing evidence implicating DLK1 in fibrotic processes, its role in pulmonary fibrosis and the regulation of AT2 differentiation remains unclear. This study was designed to assess the involvement of DLK1 in the pathogenesis of BLM-induced lung fibrosis and to investigate the potential mechanisms through which DLK1 mediates its effects. By addressing these questions, we aim to provide new insights into the therapeutic potential of targeting DLK1 in pulmonary fibrosis.

Materials and methods

Materials

The reagents and antibodies used in this study are listed in Tables S1 and S2.

Ethics and animals

Wild-type C57BL/6 N male mice (male, 8–10 weeks old) were purchased from Beijing Vital River Laboratory Animal Technology (Beijing, China). SFTPC-EGFP mice were kindly provided by Dr. Zhang Yuzhen of Shanghai East Hospital, who obtained them from The Jackson Laboratory (Jax Cat# 028356). Both types of mice were kept in a specific-pathogen-free (SPF) environment under controlled conditions of temperature (23–24 °C), humidity (55 ± 5%), and light (12 h/12 h light–dark cycle). The mice had free access to food and water. The in vivo manipulations were approved by the Institutional Animal Care and Use Committee of Tongji University (Number: TJBB00122107), and they were performed following ethical guidelines. The grouping of mice was randomized using computer-generated random numbers.

Patient samples

Lung specimens were collected from 11 patients with IPF through lung biopsy, and the the control samples were obtained from the parenchyma of 11 lung cancers patients. This study was approved by the Ethics Committee of The Affiliated Hospital of Qingdao University (QYFY WZLL 27659), and informed consent was obtained from each patient. All experiments were performed following relevant guidelines and regulations.

Animal model of BLM-induced fibrosis

For establishing the BLM-induced fibrosis model, mice were humanely euthanized by administering 50 mg/mL of sodium pentobarbital (0.6 mg/10 g body weight). Under anesthesia, 3 mg/kg of bleomycin sulfate was administered intratracheally via a 20-gauge catheter; the control mice received an equal amount of PBS as the vehicle. They were weighed every two days. Micro-CT was conducted, and lung tissues and bronchoalveolar lavage (BAL) fluid were collected on day 14. Approximately 1 mL of PBS was used for the lavage, and cells in the BALF were used for Flow Cytometry (FCM) analysis while their supernatant was stored in a freezer at –80 °C. All pathological examinations were conducted on the left lung, while the right lung was frozen in liquid nitrogen and kept at –80 °C for the following experiments.

Production and injection of AAV

The AAV-6 constructs were established using the pHBAAV-U6-MCS-CMV-mCherry vector and the mouse DLK1 gene, constructed by Hanbio Biotechnology (Shanghai, China). The sequence of short hairpin RNA (shRNA) was as follows: AATTCGACGGGAAATTCTGCGAAATTCAAGAGATTTCGCAGAATTTCCCGTCTTTTTTG (Topstrand);GATCCAAAAAAGACGGGAAATTCTGCGAAATCTCTTGAATTTCGCAGAATTTCCCGTCG (Bottom strand). The vector sequence was removed, and the recombinant AAV was generated by transfecting 293 T cells. The AAV particles in the cell culture medium were precipitated with ammonium sulfate and purified through ultracentrifugation on an iodixanol gradient. The particles were then concentrated by replacing iodixanol with Lactate Ringer's solution via multiple steps of dilution and concentration. After validating their efficiency by SDS-PAGE, immunofluorescence, and RT-PCR, 6 × 1010 viral genomes of either AAV-siDLK1 or AAV-NC were administered intratracheally into the lungs of mice, followed by treatment with BLM or PBS after seven days. The mice were monitored and harvested at predetermined time points.

Mouse lung dissociation and flow cytometry

Mice were anesthetized, and their lungs were perfused with 5 mL of cold PBS and digested in HBSS for 30 min at 37 °C using several enzymes, including Collagen I (400 U/mL; Worthington), Dispase (5U/mL; Corning), Elastase (4 U/mL; Worthington), and DNase I (100 u/mL; Sigma) [18]. After neutralizing with an equal quantity of 10% FBS-contained DMEM medium, single-cell suspensions were filtered using a 100-µm cell strainer and washed with HBSS. Then, red blood cell lysis was performed, and the cells were blocked with CD16/32 and stained for flow cytometry or FACS. Briefly, primary antibodies for AT2, including CD31-PECy7, CD34-PECy7, CD45-PECy7, CD24-BV421, EpCAM-APC, and Sca-1-AF488, or antibodies for macrophages, including CD45-PEcy7, CD11b-BV510, Ly6G-APC, F4/80-BV421, CD80-PE, and CD206-FITC, were added to incubate cells for 15 min in the dark and 7-AAD or zombie yellow was added to identify dead cells.

For BALF staining, the cells were centrifuged at 400 g in 4 °C for 5 min and blocked with CD16/32 antibody. Then, they were stained with specific antibodies for 15 min, followed by washing and resuspension. Flow cytometry was performed using BD-LSR Fortessa flow cytometer and FACSAria III sorter (BD Immunocytometry Systems, San Jose, CA) and analyzed using the Flow Jo 10.8.1 software (Tree Star, Ashland, OR).

Cell culture and treatment

The human lung fibroblast cell line MRC5 was obtained from ATCC (Catalog CCL-171) and cultured in a minimum essential medium (MEM). The alveolar epithelial cell line A549 was purchased from ATCC (Catalog CCL-185) and maintained in our laboratory. Primary lung fibroblasts (PLFs) were isolated and purified from single-cell suspensions [18]. Primary alveolar epithelial AT2 cells of mice were isolated by FACS and cultured on gelatin-covered dishes in DMEM/F12 medium.

For establishing the in vitro fibrosis models, A549, MRC5, and PLFs cells were treated with 10 ng/mL TGF-β for 48 h, and then, related fibrotic genes were analyzed by PCR or Western blotting to confirm that the models were successfully established. For DLK1 intervention, the cells were transfected with si-DLK1 by lipo3000 (Invitrogen, USA) for 6 h. Then, the medium was changed, and the cells were stimulated with 10 ng/mL TGF-β for another 48 h. As the expression of DLK1 was negligible in PLFs, they were pretreated with the DLK1 recombinant protein (re-DLK1) at different concentrations for 6 h and then treated with 10 ng/mL TGF-β. Finally, PCR, Western blotting, and IF were performed to evaluate the role of DLK1 in fibrosis.

Transfection of siRNA

Three siRNA sequences were designed to downregulate human DLK1 (GenePharma, China). A549 or MRC5 cells were seeded in the plates without antibiotics and then transfected with si-DLK1 (100 pmol) using lipofectamine 3000 (Invitrogen, USA) following the manufacturer's instructions. Scrambled siRNA (100 pmol) was used as a negative control (NC) in A549 and MRC5 cells. After 6 h, the cells were washed and changed to DMEM/F12 medium containing 1% FBS and starved for 12 h. Then, they were incubated with TGF-β1 (10 ng/mL) for another 48 h for the following analysis. The efficiency of each si-DLK1 was validated, and their sequences were as follows:

  • DLK1 244:GGAGCUCUGUGAUAGAGAUTT,AUCUCUAUCACAGAGCUCCTT;

  • DLK1 486:CAGGCAAUUUCUGCGAGAUTT,AUCUCGCAGAAAUUGCCUGTT;

  • DLK1–861:CCAUGAAAGAGCUCAACAATT,UUGUUGAGCUCUUUCAUGGTT.

Histopathologic and IHC analysis

Mice from the BLM-induced fibrosis group were humanely sacrificed on days 7, 14, and 21 post-BLM administration. Mice in the AAV-siDLK1 and AAV-NC pretreated groups were analyzed on d14 and d21 after BLM intervention. The left lungs were excised, fixed in 4% formaldehyde, and then dehydrated, embedded, and deparaffinized for hematoxylin and eosin (H&E), Masson, and Sirius red staining. Fibrotic severity was evaluated using a modified Ashcroft scoring system. Ten randomly selected fields per section were independently scored by two blinded pathologists according to the following criteria: 0: Normal parenchymal architecture; 1: Focal septal fibrosis without architectural distortion; 2: Multifocal fibrotic nodules in alveolar walls; 3: Interconnected fibrotic septa forming micro-networks; 4: Discrete fibrotic foci (≤ 200 um); 5: Confluent fibrotic lesions (200-500um); 6: Extensive fibrotic consolidation (> 500um); 7: Subpleural honeycombing with cystic remodeling; 8: Complete alveolar obliteration by dense fibrosis.

For immunohistochemistry, paraffin sections of human lungs were deparaffinized, and subjected to antigen retrieval and methanol treatment. They were blocked by 5% donkey serum and incubated with the DLK1 antibody overnight at 4 °C. After washing, the slides were incubated with species-specific secondary and streptavidin-HRP for signal amplification and visualized with diaminobenzidine (DAB). Bright-field images were captured with an upright microscope (Leica, Wetzlar, Germany).

Hydroxyproline quantification

Hydroxyproline levels in lung tissues were determined using a commercial assay kit (Sigma-Aldrich, MAK008) according to the manufacturer’s instructions. Briefly, tissues were homogenized in cold PBS and subjected to acid hydrolysis in 12M HCl at 120 °C for 3 h. Hydrolysates were neutralized and clarified by centrifugation(10000 g, 5 min). The supernatant was incubated with Chloramine-T/Oxidation buffer, followed by reaction with Diluted DMAB reagent at 60 °C for 90 min. Absorbance was measured at 560 nm (SpectraMax M5 microplate reader, Molecular Devices), and hydroxyproline content was normalized to tissue wet weight (ug/g) All samples were analyzed in triplicate with blank controls to exclude background interference.

Immunofluorescence staining and confocal microscopy

Paraffin sections and SPC-EGFP labeled cryosections were stained. Lung sections were permeabilized with 0.25% Triton X-100 for 15 min and blocked with 10% bovine serum albumin (BSA) for 1 h. Then, they were incubated with primary antibodies overnight, including anti-CD45 and anti-F4/80 antibodies; anti–α-SMA, collagen I, Ki67, SFTPC, and Pdpn (T1a). After washing thrice, the samples were incubated with fluorescently labeled secondary antibodies for 1 h at room temperature in the dark. After DAPI staining, images were captured using a fluorescence microscope (Leica, Wetzlar, Germany). The number of SPC+ cells and SPC+/Ki67+ were counted in six random views of each lung section at 40X.

Matrigel culture of mouse AT2 cells

Primary AT2 cells were sorted from SPC-EGFP mice and cultured in a Matrigel/medium (1:1) mixture with PLFs [5, 19]. Specifically, 3 X 103 AT2 cells and 2 X 105 PLFs were added to 100 µL of Matrigel/medium and plated in a 0.4 um Transwell insert. Then, 400 µL of the indicated medium was added to the lower chambers [20]. Cultures were maintained in an incubator at 37 °C and 5% CO2, and the medium was refreshed every other day. After 14 days of culture, organoids were fixed in 2% paraformaldehyde, sectioned, and immunostained with SPC and T1a. The colonies were captured with a Zeiss Axiovert40 inverted fluorescent microscope (Carl Zeiss AG, Oberkochen, Germany).

Western blotting (WB)

Lungs from different groups were homogenized and lysed with RIPA, and the cells were collected with RIPA buffer. Then, the Bicinchoninic acid assay (BCA) kit (ThermoFisher Scientific) was used following the manufacturer's instructions. All proteins were separated by electrophoresis and transferred onto PVDF membranes (Millipore). After blocking with 5% non-fat milk in TBST for 1 h, the membranes were incubated with primary antibodies overnight at 4 °C, followed by incubation with corresponding secondary antibodies for 1 h. Then, the bound antibodies were detected by fluorescence or Enhanced Chemiluminescence (ECL) reagent (Share-Bio).

Quantitative real-time polymerase chain reaction analysis

Real-time quantitative polymerase chain reaction (RT-qPCR) was performed to determine the expression of related genes. Mice lungs from AAV-NC and AAV-siDLK1-treated groups were collected 14 d and 21 d after BLM administration. MRC5 or A549 cells were collected after TGF-β intervention for 48 h following treatment with siDLK1. Total RNA was isolated by TRIzol reagent (Invitrogen), reverse transcribed into cDNA using the PrimeScript RT kit (Takara Bio, Inc), and reacted in a 10 µL reaction system using cDNA, specific primers and SYBR Green MasterMix (Applied Biosystems; Thermo Fisher Scientific, Inc.); three replicates of the experiment were performed. The samples were then analyzed by the Applied Biosystems ViiA 7 Real-Time PCR System (Thermo Fisher Scientific). The relative expression levels of the genes were calculated by the 2−∆∆CT method. The primers used in this study are presented in Supplementary Table 2.

RNA-Seq analysis

Total RNA was isolated from fresh AT2 cells using TRIzol reagent. The quality of the RNA was assessed using an Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA). Then, the enriched mRNA was fragmented using a fragmentation buffer and reverse transcribed into cDNA using the NEBNext Ultra RNA Library Prep Kit for Illumina (NEB #7530, New England Biolabs, Ipswich, MA, USA). The purified double-stranded cDNA fragments were end-repaired, and then, a base was added and ligated to Illumina sequencing adapters. The ligation reaction was purified using AMPure XP Beads (1.0X). Next, polymerase chain reaction (PCR) was performed for amplification, and the resulting cDNA library was sequenced using Illumina Novaseq6000 (Gene Denovo Biotechnology Co.; Guangzhou, China).

Micro-computed tomography

The lungs of AAV-NC and AAV-siDLK1 pretreated mice were scanned 14 days after BLM intervention using SkyScan 1276 micro-CT (Bruker, Belgium) [21]. The mice were anesthetized with 2% isoflurane and then placed in a supine position inside the micro-CT scanner. The parameters of CT scanning were as follows: 90 kV, 88 µA over a total angle of 360°, with a total scan time of 4 min using the'high speed'scan mode with respiratory gating. For data processing, the 3D reconstructed datasets were analyzed using the Perkin Elmer Analysis software.

Non-invasive measurement of lung function

The lung function of BLM-treated mice from the AAV-NC and AAV-siDLK1 groups was measured using the whole-body plethysmography (WBP) method. Briefly, the WBP device was connected to a data collection software IOX2, and the connection to the device was checked. After all the channels were calibrated, the mice were placed in the chamber and allowed to acclimate for about 20 min. The data were recorded for 5 min when the mice were stable and breathing smoothly. IOX2 automatically recorded the breathing wave value of the mice every 10 s, and the 10 primary parameters recorded included inhale time (Ti), exhale time (Te), peak expiratory flow (PEF), tidal volume (TV), exhaled volume (EV), relaxation time (RT), minute ventilation (MV), breathing frequency (f), forced breathing gap (Penh), and the 50% exhaled flow rate (EF).

Statistical analysis

The data were calculated as the mean ± standard error of the mean (SEM) and analyzed using GraphPad Prism 8.0 (GraphPad Software, Inc.). For comparing data between groups, Student's t-tests were performed for non-paired replicates, while comparisons among multiple groups were performed by the one-way analysis of variance (ANOVA), followed by Tukey's multiple comparison tests. All differences among and between groups were considered to be statistically significant at p < 0.05.

Results

DLK1 was upregulated in fibrotic lungs

In order to determine the expression of DLK1 in pulmonary fibrosis, we collected lung tissues from 11 patients with IPF (Table 1) and 11 control donors with lung cancers. The mRNA of DLK1 in IPF lungs was about four-fold higher than that in the non-IPF disease controls (Fig. 1A). Western blotting results showed a significant increase of DLK1 protein in IPF patients (Fig. 1B and C). Further IHC results revealed that the DLK1-positive areas in IPF lungs were twice that from healthy individuals (Fig. 1D and E). These results indicated that DLK1 expression is upregulated in lungs of IPF patients.

Table 1 The baseline characteristics of the IPF patients
Full size table
Fig. 1
figure 1

Increased expression of DLK1 in pulmonary fibrosis. A Relative mRNA expression of DLK1 in the Non-IPF disease control and IPF patients. B-C Western blot analysis of DLK1 and Collagen1 in HD and IPF patients. D-E Representative immunohistochemistry images of DLK1 in HD and IPF patients. F, G Western blot analysis of DLK1 in BLM-induced murine lung tissues and control lungs. H Relative mRNA expression of DLK1 in BLM-induced fibrotic lungs and control lungs. I-J Representative fluorescence images of DLK1 (red) and DAPI (blue) in control and 7,14,21 days post-BLM induction, the scale bar 50um. Data are presented as mean ± SEM

Full size image

To assess whether there were similar changes in murine fibrotic lung, we constructed the most classical bleomycin-induced fibrosis model. First, the pathological process was confirmed by H&E and Masson staining at the indicated times (Supplementary Fig. 1 A), along with the Ashcroft score, hydroxyproline assay, and PCR analysis of fibrotic genes. (Supplementary Fig. 1B-D). It found that both DLK1 protein and mRNA levels were higher on day 14 in lungs of BLM mice compared to control group (Fig. 1F, G, and H). Immunofluorescence staining results showed that the expression of DLK1 was the highest on day 14 compared to day 7 and day 21(Fig. 1I and J). Additionally, the dynamic protein changes in the whole process were analyzed by Western blotting (Supplementary Figs. 1E-F) and flow cytometry (Supplementary Figs. 1G,H,I). Those results confirmed that DLK1 was upregulated in the fibrotic lungs of human and mice.

DLK1 was predominantly expressed in AT2 cells during pulmonary fibrosis

In order to uncover the cell specific expression of DLK1 during fibrosis, SPC-EGFP mice were used for FCM analysis. As shown by Fig. 2A, more than 85% of SPC+ AT2 cells had a prominent expression of DLK1 in the baseline. Further co-staining of DLK1 with pro-SPC, CD45, or collagen1 was performed independently to confirm its expression in different cell types which were reported to mainly participate in lung fibrosis [3, 22]. The co-expression of DLK1 with the AT2 marker pro-SPC increased on days 7 and 14 post-BLM induction compared to the baseline (Fig. 2B and C). Although a small proportion of CD45+ cells express DLK1, there are no significant differences of this ratio between control and BLM groups (Fig. 2D and E). Further FCM analysis revealed that DLK1 was nearly absent in macrophages and fibroblasts (Fig. 2F), which also remained scarce in collagen+ mesenchyme (Supplementary Fig. 2 A). Taken together, among the three most prominent types of cells involved in lung fibrosis, DLK1 is most abundantly expressed in AT2 cells and its expression is markedly upregulated after BLM treatment.

Fig. 2
figure 2

Cell specificity and dynamic changes of DLK1 in AT2 cells during fibrosis. A FCM analysis of DLK1 in control SPC-EGFP mice, indicating that most AT2 are DLK1 positive cells. B, C Co-immunostaining of DLK1 (red), pro-SPC (green), and DAPI (blue) shows a predominant expression of DLK1 on AT2 cells, the scale bar 50um. D, E Co-immunostaining of DLK1 (red), CD45 (green), and DAPI (blue) in the lung from control and BLM-induced mice, the scale bar 50um. F FCM analysis of DLK1 expression in Macropahes and fibroblasts in control and 14 day post-BLM-inducted mice. Data are presented as mean ± SEM

Full size image

AAV6-mediated alveolar epithelial knockdown of DLK1 alleviated BLM-induced fibrosis

To determine whether this cell specific expression of DLK1 regulates lung fibrosis, adeno-associated virus (AAV) was designed to knock down DLK1 in epithelial cells (Fig. 3A). The cellular target and efficiency of AAV were tested by immunofluorescence (Supplementary Figs. 2B and C), which also showed a significant DLK1 reduction at protein levels (Supplementary Figs. 2D and E). We found that AAV-siDLK1 treatment markedly alleviated pulmonary fibrosis induced by BLM (Fig. 3B). AAV-siDLK1 also decreased the collagen deposition and degree of fibrosis, as determined by Sirius Red staining (Fig. 3C) and micro-CT (Fig. 3D). Furthermore, both protein and mRNA levels of a-SMA, vimentin, and collagen1 were much lower in AAV-siDLK1 treated lungs than that of the control (Fig. 3E, F, and G).

Fig. 3
figure 3

Alveolar epithelial knockdown of DLK1 alleviated BLM-induced fibrosis. A Schematic diagram of AAV-6 mediated epithelial knockdown of DLK1 following BLM-treated mice. B, C pathological analysis by H&E, Masson and Serius Red staining in the AAV-NC or AAV-siDLK1 treated mice, the scale bar 200um. D Representative Micro-CT images of lungs in control, AAV-NC, and AAV-siDLK1 treated BLM mice. E Relative mRNA expression of collagen1, a-SMA, TGF-β, and fibronectin in control, AAV-NC, and AAV-siDLK1 treated BLM mice. F Western blot analysis of vimentin and a-SMA in AAV-NC and AAV-siDLK1 treated BLM mice. G Representative fluorescence images of collagen1 (green) or a-SMA(green) and DAPI (blue) in control, AAV-NC, and AAV-siDLK1 treated BLM mice the scale bar 50um. Data are presented as mean ± SEM

Full size image

Inflammatory infiltration is another crucial pathological feature in the early stage of fibrosis. We then evaluate whether DLK1 can affect inflammation in this process. FCM results showed that AAV-siDLK1 treatment downregulated the CD45+ cells to about 30% compared to the NC control group at 60% (Supplementary Figs. 3 A and B), while neutrophils slightly increased. The immunofluorescence results showed a reduction in CD45+F4/80+macrophage infiltration (Supplementary Fig. 3 C, D). As dysregulated AECs might recruit fibroblasts through chemokines, the levels of CXCR4 and CXCL12 were assessed, and it showed that AAV-siDLK1 only upregulated CXCL12 expression slightly (Supplementary Fig. 3E). Although lung function results showed no significant difference, pathological findings suggested that knockdown of DLK1 significantly alleviated pulmonary fibrosis (Supplementary Fig. 3 F).

Knocking down of DLK1 decreased alveolar injury in murine fibrosis models

The recovery of AT2 is necessary to prevent the development of fibrosis. Then, SPC-EGFP positive cells, and CD24– Sca-1– cells in CD45– CD31– CD34– Epcam+ cells were applied to determine whether AAV-siDLK1 affect AT2 cells [18]. The gating strategy and the variation during fibrosis were supplied in Supplementary Figs. 4 A-D. Both proportion and number of AT2 cells decreased in BLM group compared to the NC control while they were restored by the conditional knockdown of DLK1 (Fig. 4A-E). Further immunofluorescence analysis revealed the similar changes in these three groups (Fig. 4F).

Fig. 4
figure 4

Conditional knockdown of DLK1 caused less alveolar epithelial injury during fibrosis. A FCM analysis of the proportion of AT2 cells in control, AAV-NC, and AAV-siDLK1 treated SPC-EGFP mice. B-E CD24- Sca-1- AT2 cells were analyzed, Epcam + cells in total cells and the number of AT2 were calculated. F Representative fluorescence images of SPC (green) and DAPI (blue) were performed in the indicated group, the scale bar 50um. G, H FCM analysis of CD45 + and SPC-EGFP positive AT2 in BALF. I, J TUNEL staining was analyzed in control, AAV-NC, and AAV-siDLK1-treated BLM mice. K Western blot analysis of Bcl-2 and BAX in AAV-NC and AAV-siDLK1 treated BLM mice. Data are presented as mean ± SEM

Full size image

Epithelial cells function as a barrier, and disruption of the integrity of this barrier can increase macromolecular permeability [23], which can hamper tissue repair and lead to fibrosis [24]. To examine the integrity of the barrier, total immune cells and AT2 cells in BALF were analyzed. The CD45+ cells and AT2 cells in the BALF of the AAV-siDLK1 group were lower than that of NC group (Fig. 4G and H). TUNEL staining showed that AAV-siDLK1 treatment decreased the apoptosis of total cells, but did not affect the apoptosis of AT2 cells in the lungs (Fig. 4I and J). In addition, WB results showed much higher ratio of Bcl2/BAX in the AAV-siDLK1 group than that in the control group (Fig. 4K).

The proliferation and differentiation of AT2 cells were promoted by si-DLK1

Loss of AT1 cells exacerbates pulmonary fibrosis [20]. Fortunately, AT2 cells can renew and differentiate into AT1 cells after lung injury [9, 25]. Next, in order to determine whether DLK1 regulate the epithelium recovery, we evaluated the renewal and differentiation of AT2 cells after different treatments in vivo and in vitro. As shown by Fig. 5A, addition of AAV-si-DLK1 increased the proportion of SPC+Ki67+AT2 cells in lung compared to the control group on day 14, which showed a similar trend on day 21 (Supplementary Fig. 5 A). To further explore the role of DLK1 in AT2 differentiation, the AT1 marker AQP5 was stained in SPC-EGFP mice. We found that ratio of SPC+AQP5+ cells was higher in the AAV-siDLK1 group than that of AAV-NC on day 14 (Fig. 5B) and day 21 (Supplementary Fig. 5B) after BLM induction. These results suggested that epithelial DLK1 knocking down contribute to AT2 proliferation and differentiate into AT1 cells in BLM induced murine lung fibrosis models.

Fig. 5
figure 5

Knockdown of DLK1 promoted AT2 proliferation and differentiation. A Representative fluorescence images of SPC (green), Ki67(red), and DAPI (blue) on day 14 in AAV-NC and AAV-siDLK1 treated BLM mice, the scale bar 50um. B Representative fluorescence images of SPC (green), AQP-5(pink), and DAPI (blue) on day 14 in the indicated group. C Western blot analysis of PCNA and collagen 1 in TGF-β induced A549 cells that were pretreated with siDLK1 or reDLK1 6 h before TGF-β supply. D Representative fluorescence images of T1a (red) and DAPI (blue) in fresh isolated SPC-EGFP labelled AT2 cells supplied with the control medium or 100ng/ml recombinant DLK1, the scale bar 50um

Full size image

To assess the effect of DLK1 on the proliferation of AT2 in vitro, the alveolar epithelial cell line A549 was either supplied with recombinant protein (re-DLK1) or silenced by si-DLK1. WB analysis showed that PCNA expression was lower after the addition of re-DLK1 compared to that in the TGF-β control, while si-DLK1 treatment rescued its expression (Fig. 5C). Then fresh primary AT2 cells were isolated and cultured in 3D organoids, finding that the 100 ng/mL DLK1-treated group had fewer colonies in the bright field than the DMEM control group (Supplementary Figs. 5 C, D), which indicated that DLK1 inhibited AT2 regeneration in the 3D organoid and 2D culture. In order to determine their impact on differentiation in vitro, AT2 cells were sorted from SPC-EGFP mice and supplied with 100 ng/mL re-DLK1 until they were adherent. After 48 h or 72 h of culture, the cells were fixed with 4% PFA and stained with the Type 1 cell marker T1a. Compared to the control group, the 100 ng/mL DLK1-treated group showed a significant decrease in SPC+T1a+ cells. Their shape changed to a flattened AT1-like morphology (Fig. 5D), which indicated that DLK1 inhibited the differentiation of progenitor AT2 cells into AT1 cells.

Recombinant DLK1 exacerbated fibrosis, while si-DLK1 alleviated itin vitro

To assess the role of DLK1 on fibrosis in vitro, we established two fibrosis cell models. Firstly, we found that the level of DLK1 was higher in TGF-β-induced A549 and MRC5 cells (Fig. 6A and B). Addition of re-DLK1 upregulated two profibrotic genes, including TGF-β and fibronectin, in A549 cells (Fig. 6C). WB results showed that Collagen 1 was inhibited by si-DLK1 but augmented by re-DLK1 in MRC5 cells (Fig. 6D), suggesting a profibrotic potential of DLK1 in the baseline. Next, the cells were pretreated with re-DLK1 or si-DLK1 for 6 h, followed by TGF-β1 stimulation (Fig. 6E). PCR analysis showed that the fibrosis-related genes, including fibronectin, a-SMA, and TGF-β1, were lower in si-DLK1-pretreated MRC5 cells compared to that in the TGF-β1 control cells, while re-DLK1 intervention upregulated these genes (Fig. 6F). A similar pattern was found in A549 cells (Supplementary Fig. 6 A),with their efficiency of si-DLK1 confirmed in Supplementary Figs. 6B and C. WB results showed that si-DLK1 neutralized the expression of Collagen 1 and a-SMA, while re-DLK1 compromised this protective role (Fig. 6G). Immunostaining of MRC5 and A549 cells also showed that silencing DLK1 inhibited the expression of Collagen I (Fig. 6H, Supplementary Fig. 6D).

Fig. 6
figure 6

Re-DLK1 promoted TGF-β induced fibrosis and si-DLK1 rescued it in vitro. A, B Relative mRNA expression of DLK1 in A549 cells or MRC5 cells treated with either control medium or 10ng/ml TGF-β for 48 h. C Relative mRNA expression of TGF-β1 and fibronectin in A549 cells treated with either control medium or 50ng/ml re-DLK1 for 48 h. D Western blot analysis of collagen1 and DLK1 in MRC5 cells treated with either control medium or 50ng/ml re-DLK1 for 48 h. E Flow chart of in vitro intervention. F Relative mRNA expression of fibronectin, a-SMA, TGF-β1 in MRC5 cells treated with si-DLK1 or 50ng/ml re-DLK1 followed by TGF-β stimulation for 48 h. G Western blot analysis of Collagen1 and a-SMA in MRC5 cells in the indicated group. H Representative fluorescence images of collagen 1 (green) and DAPI (blue) in MRC5 cells treated with or without si-DLK1 followed by TGF-β induction for 48 h, the scale bar 50um. I Relative mRNA expression of TNF-a, fibronectin, TGF-β1 and vimentin in primary lung fibroblasts treated with 0,10,25,50,100,200ng/ml re-DLK1 followed by TGF-β intervention for 48 h

Full size image

To more accurately simulate the effects of DLK1 in vivo, primary lung fibroblasts were pretreated with re-DLK1 at different concentrations, followed by TGF-β1 stimulation. We found that 50 ng/mL of DLK1 increased the expression of pro-inflammatory and profibrotic genes, such as TNF-a, TGF-β, fibronectin, and vimentin (Fig. 6I). Fibronectin levels increased significantly after treatment with 10 ng/mL of DLK1. However, there were no significant difference in the expressions of Collagen 1, a-SMA, and IL-6 between re-DLK1 treated groups and the control(Supplementary Figs. 6E and F). These findings indicated that knocking down of DLK1 in lung epithelial cells help to alleviate fibrosis. Collectively, these results suggested the profibrotic role of DLK1 under both baseline and the fibrotic conditions.

DLK1 contributes to fibrosis by inhibiting TTF-1/CLDN6 in AT2 cells

To elucidate the mechanism of DLK1 on AT2 cells during pulmonary fibrosis, fresh AT2 cells were isolated from AAV-NC and AAV-siDLK1-treated mice following BLM injury. RNA sequencing results of these cells showed that there were 56 upregulated genes and 4 downregulated genes in the AAV-siDLK1-treated group compared to the AAV-NC, most of which are involved in fibrotic diseases (Fig. 7A-D). Among these differentially expressed genes (DEG), CLDN6 was significantly upregulated in AT2 cells of AAV-siDLK1-treated mice. As a four-transmembrane protein of the tight junction family (TJs), it is preferentially expressed in mammary epithelial cells with a traditional barrier function [26, 27]. We then confirmed that both mRNA and protein levels of CLDN6 increased considerably in the conditional DLK1 knockout group (Fig. 7E and G). To further explore how DLK1 affect the expression of CLDN6, we analyzed the corresponding transcription factors (TFs), including thyroid transcription factor (TTF-1, also known as Nkx2.1), Gata-6, and FoxA2, which were reported to control alveolar epithelial cell differentiation via CLDN6 during lung morphogenesis [28]. As shown by Fig. 7F, suppression of DLK1 increased the TTF-1 expression in AT2 cells. Further WB assay revealed that DLK1 was upregulated while TTF-1 was downregulated in the IPF lung compared to the control (Fig. 7H). In addition, immunofluorescence staining demonstrated the spatial colocalization of DLK1 and TTF-1 in SPC+ AT2 cells (Fig. 7I). Collectively, these results suggested that DLK1 may directly act with TTF-1 and then regulate the expression of CLDN6 thereby mediating AT2 differentiation.

Fig. 7
figure 7

Mechanism of DLK1 in AT2 during fibrosis. A-D RNA sequence analysis of primary AT2 cells in AAV-NC and AAV-siDLK1-treated BLM mice (n = 3/group). A The top 20 genes in AT2 cells upregulated by AAV-siDLK1 intervention compared with AAV-NC-treated mice. B, C, D GO, BP and pathway analysis of this sequence. E Relative mRNA expression of CLDN6 in the indicated group. F mRNA expression of related transcription factors that regulated those upregulated genes, such as TTF-1, Gata-6, FoxA2 and NF-kB. G Western blot analysis of TTF-1 and CLDN6 in AAV-NC and AAV-siDLK1-treated BLM mice (n = 4/group). H Western blot analysis of DLK1, TTF-1, a-SMA in Healthy donors and IPF patients. I Co-immunostaining of DLK1 (yellow), SPC (pink), TTF-1(green) and DAPI (blue) in lungs of BLM-induced mice, the scale bar 50um. J Western blot analysis of related signals in A549 cells, including TGF-β/Smad 2/3/AKT/NF-kB. The cells were treated with or without re-DLK1 followed by TGF-β stimulation. K Western blot analysis of related signals in AAV-NC or AAV-siDLK1 treated mice

Full size image

Epithelial phosphatase and tension homolog (PTEN) is an important gatekeeper controlling ALI and PF by modulating the integrity of AECs through the PTEN/PI3 K/Akt pathway [29], and the deletion of PTEN driven by TTF-1-Cre provides resistance to airway injury [30, 31]. Thus, we determined whether DLK1-mediated suppression of TTF-1 can regulate the PTEN/PI3 K/Akt pathway. In TGF-β-induced A549 cells, re-DLK1 activated TGF-β/Smad 2/3 and Akt/NF-kB signaling, two classical signaling pathways involved in fibrosis (Fig. 7J). The PTEN/PI3 K/AKT pathway can be regulated by TGF-β/Smad 2/3 signaling [32]. As shown by Fig. 7K, administration of AAV-siDLK1 suppressed TGF-β/Smad2/3 signaling and increased the expression of PTEN, which inhibited PI3 K/AKT/NF-kB following the upregulation of TTF-1.

Discussion

Idiopathic pulmonary fibrosis (IPF) is a progressive age-related disease that deteriorates lung function. So far, no specific treatment is available for IPF. Previous studies have shown that AECs play a vital role in lung homeostasis, and abnormally activated AECs promote the initiation of IPF. Therefore, the mechanism in which the integrity of AECs is regulated and the potential therapeutic targets in the process still needs to be explored.

The paternally imprinted gene DLK1 belongs to the Notch/Delta/Serrate family, with distinguished roles in tissue differentiation and cancer stemness [33], especially has tumor-supportive functions in many aggressive cancers. While DLK1 remains absent in most tissues postnatally, it is often upregulated in various prevalent pediatric tumors including neuroblastoma, nephroblastoma, hepatoblastoma and even certain aggressive adult cancers [34,35,36]. Studies have linked excessive DLK1 expression with enhanced malignancy and unfavorable patient prognosis in diseases such as glioblastoma (GBM), hepatocellular carcinoma and lung cancer [37,38,39]. Besides, DLK1 has been reported to play various roles in several fibrotic deseases, including aggravate liver fibrosis while alleviate myocardial fibrosis [11, 12]. In this study, we found that DLK1 was higher in both IPF and BLM-induced fibrotic lung compared to that in non-IPF controls, which was parallel to the finding that DLK1 was overexpressed in patients with airway fibrosis of chronic obstructive asthma compared with healthy individuals [17].

Recently, AAVs have emerged as a prominent platform for gene delivery across various human diseases due to their low immunogenicity, minimal toxicity, and ability to transduce both proliferating and non-dividing cells [40, 41]. Notably, AAV-based therapies have shown significant potential in the treatment of respiratory diseases, including cystic fibrosis (CF), asthma, pulmonary hypertension, and COPD [42, 43]. The application of AAV vectors in respiratory diseases dates back to 1999, when the first clinical trial utilized a recombinant AAV2 carrying the CFTR gene (rAAV2-CFTR) [44]. Delivered intranasally and via bronchial routes, this trial demonstrated an excellent safety profile in CF patients, though therapeutic efficacy was not extensively evaluated at the time [45]. Subsequent clinical studies reaffirmed the safety of rAAV2-CFTR, even at doses as high as 1013 vg per administration [46, 47].

The success of AAV vectors in clinical settings has been further substantiated by preclinical studies exploring different AAV serotypes. Various serotypes exhibit distinct tropisms toward specific organs or cell types, which is critical for achieving targeted gene delivery [43]. In the context of lung diseases, AAV6 has demonstrated a particular affinity for alveolar epithelial cells, a key target for pulmonary gene therapies. Consistent with these findings, our study employs AAV6 to deliver a gene-silencing construct aimed at knocking down DLK1 expression in alveolar epithelial cells. Our results confirm the high efficiency of AAV6-mediated DLK1 knockdown, underscoring its potential as a precise and effective vector for therapeutic interventions targeting alveolar epithelial cell dysfunction.

As IPF is an insidious progressive lung disorder with few therapeutic option, currently pirfenidone and nidanib, two efficient drugs approved by the FDA, can only delay disease progression without reversing existing fibrosis, it is imperative to identify potential targets for reversing established fibrosis [48]. According to the previous reports [49, 50] and our current results, murine lung fibrosis induced by BLM was established on day 7, while it took at least 2–3 weeks for AAV-si DLK1 came into effect in vivo. In other words, BLM-induced fibrosis was already established before AAV- si-DLK1 works, indicating that epithelial knockdown of DLK1 could ameliorate the established fibrosis in murine lung fibrosis models.

Previous study confirmed that dysregulated inflammation is a cause of lung fibrosis [51], and cumulative results suggest that macrophages activate acute or chronic inflammatory responses during IPF [52]. We further found that epithelial knockdown of DLK1 limited the exudation of CD45+ immune cells in BALF, reduced the infiltration of CD45+F4/80+ macrophages and decreased collagen deposition in the BLM treated lungs, which may partly account for the alleviation of fibrosis.

Patients with IPF suffer severe loss of type I pneumocytes. Previous study showed that the differentiation of AT2 into AT1 is necessary for restoring the structure and function of the alveolar epithelium [53]. Several signaling pathways including Notch, BMP, Wnt/β-catenin and YAP/TAZ are involved in AT2 differentiation [54,55,56,57]. Recently Finn et al. showed that DLK1 can mediate the differentiation of AT2 into AT1 in Pseudomonas aeruginosa-induced acute lung injury [9]. The present study found that DLK1 was expressed predominantly in AT2 cells yet nearly absent in immune or mesenchymal cells. We further confirmed the colocalization of DLK1 and TTF-1 in AT2 cells and knock down of DLK1 in AT2 increased the TTF-1 expression. Moreover, we found upregulation of DLK1 expression and downregulation of TTF-1 (Nkx2.1) level in IPF lung tissues. It is reported that TTF-1, as a critical transcription factor, controls AT2 differentiation and promotes alveolar repair during lung development [58]. Moreover, previous study confirmed that TTF-1 can transcriptionally regulate claudin-6 [59]. The latter was found to play key roles in the formation of the lung epithelial barrier and the epidermal permeability barrier [60]. Therefore, the inhibition of DLK1 may promote AT2 differentiation via up-regulation of TTF-1/CLDN6 signaling. However, how DLK1 regulates TTF-1 requires further exploration.

PTEN is an essential gatekeeper that controls acute lung injury and fibrosis by regulating the integrity of AECs through the PTEN/PI3 K/AKT pathway [29]. It is also reported to be downregulated in cystic fibrosis and controls cell proliferation by regulating PI3 K activity [61], and loss of PTEN activates the senescence of AECs, thereby promoting lung fibrosis [62]. We newly found that the tumor-suppressor gene PTEN, as well as its target PI3 K/AKT, could be regulated by DLK1/TTF-1, which may contribute to the alleviation of fibrosis.

Collectively, we uncovered for the first time that DLK1/TTF-1/CLDN6 might be the potential axle regulating AT2 differentiation in lung fibrosis. However, it remains unclear how the spatial colocalization of DLK1 and TTF-1 in AT2 cells affects AT2 differentiation. Besides, more clinical research is needed to verify the benefit of DLK1 inhibition in pulmonary fibrosis. Recently, Precision-cut lung slices (PCLS) offer a physiologically relevant ex vivo model for studying lung diseases, including pulmonary fibrosis, injury, repair, and host defense. By maintaining the structural and functional integrity of lung tissue, PCLS enable precise investigation of cellular interactions and tissue responses, bridging the gap between traditional in vitro culture and in vivo approaches [63]. Additionally, improved accessibility to human tissues has increased the application of PCLS in IPF [64]. To further testify the role of DLK1, human-PCLS will be adopt in our following program to induce an early fibrosis-like model [65], treated with recombinant DLK1 and then analyzed its influence on fibrosis as well as related pathways.

Conclusion

We find that DLK1 is predominantly expressed in AT2 cells and upregulated in patients with IPF and BLM-induced fibrosis. Epithelium-specific knockdown of DLK1 promotes its renewal and differentiation, which alleviate lung fibrosis. Conditional knockdown of DLK1 can negatively regulate TTF-1/CLDN6 and PTEN/PI3 K/Akt pathway. Thus, DLK1 may be a promising target for the treatment of IPF.

Data availability

No datasets were generated or analysed during the current study.

Abbreviations

IPF:

Idiopathic pulmonary fibrosis

DLK1:

Delta-like non-canonical Notch ligand 1

Pref-1:

Preadipocyte factor-1

AECs:

Alveolar epithelium cells

AT1:

Alveolar type 1

AT2:

Alveolar type 2 cells

BLM:

Bleomycin

TGF-β:

Transforming growth factor-β

a-SMA:

α-Smooth Muscle Actin

CLDN6:

Claudin 6

TJs:

Tight junction

TTF-1:

Thyroid transcription factor

PTEN:

Phosphatase and tension homolog

AAV:

Adeno-associated virus

BALF:

Bronchoalveolar lavage fluid

MRC5:

Medical Research Council cell strain-5

PLFs:

Primary lung fibroblasts

Bcl-2:

B-cell lymphoma 2 protein

SPC:

Surfactant protein C

TNF-a:

Tumor necrosis factor-a

micro CT:

Microcomputer tomography

F4/80:

Epidermal growth factor-like module-containing mucin-like hormone receptor-like 1

PBS:

Phosphate-buffered saline

FBS:

Fetal bovine serum

PCNA:

Proliferating Cell Nuclear Antigen

7-AAD:

7-Amino-actinomycin D

FACS:

Fluorescence-activated cell sorting

References

  1. Lederer DJ, Martinez FJ. Idiopathic Pulmonary Fibrosis. N Engl J Med. 2018;378(19):1811–23.

    Article  CAS  PubMed  Google Scholar 

  2. Richeldi L, Collard HR, Jones MG. Idiopathic pulmonary fibrosis. Lancet. 2017;389(10082):1941–52.

    Article  PubMed  Google Scholar 

  3. Moss BJ, Ryter SW, Rosas IO. Pathogenic Mechanisms Underlying Idiopathic Pulmonary Fibrosis. Annu Rev Pathol. 2022;17:515–46.

    Article  CAS  PubMed  Google Scholar 

  4. Desai TJ, Brownfield DG, Krasnow MA. Alveolar progenitor and stem cells in lung development, renewal and cancer. Nature. 2014;507(7491):190–4.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  5. Barkauskas CE, Cronce MJ, Rackley CR, Bowie EJ, Keene DR, Stripp BR, Randell SH, Noble PW, Hogan BL. Type 2 alveolar cells are stem cells in adult lung. J Clin Invest. 2013;123(7):3025–36.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  6. Gokey JJ, Snowball J, Green J, Waltamath M, Spinney JJ, Black KE, Hariri LP, Xu Y, Perl AK. Pretreatment of aged mice with retinoic acid supports alveolar regeneration via upregulation of reciprocal PDGFA signalling. Thorax. 2021;76(5):456–67.

    Article  PubMed  Google Scholar 

  7. Pittaway JFH, Lipsos C, Mariniello K, Guasti L. The role of delta-like non-canonical Notch ligand 1 (DLK1) in cancer. Endocr Relat Cancer. 2021;28(12):R271-r287.

    Article  CAS  PubMed  Google Scholar 

  8. Traustadóttir G, Lagoni LV, Ankerstjerne LBS, Bisgaard HC, Jensen CH, Andersen DC. The imprinted gene Delta like non-canonical Notch ligand 1 (Dlk1) is conserved in mammals, and serves a growth modulatory role during tissue development and regeneration through Notch dependent and independent mechanisms. Cytokine Growth Factor Rev. 2019;46:17–27.

    Article  PubMed  Google Scholar 

  9. Finn J, Sottoriva K, Pajcini KV, Kitajewski JK, Chen C, Zhang W, Malik AB, Liu Y. Dlk1-Mediated Temporal Regulation of Notch Signaling Is Required for Differentiation of Alveolar Type II to Type I Cells during Repair. Cell Rep. 2019;26(11):2942–2954.e2945.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  10. Zhang L, Kubota M, Nakamura A, Kaji T, Seno S, Uezumi A, Andersen DC, Jensen CH, Fukada SI. Dlk1 regulates quiescence in calcitonin receptor-mutant muscle stem cells. Stem Cells. 2021;39(3):306–17.

    Article  PubMed  Google Scholar 

  11. Pan RL, Wang P, Xiang LX, Shao JZ. Delta-like 1 serves as a new target and contributor to liver fibrosis down-regulated by mesenchymal stem cell transplantation. J Biol Chem. 2011;286(14):12340–8.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  12. Pan RL, Xiang LX, Wang P, Liu XY, Nie L, Huang W, Shao JZ. Low-molecular-weight fibroblast growth factor 2 attenuates hepatic fibrosis by epigenetic down-regulation of Delta-like1. Hepatology. 2015;61(5):1708–20.

    Article  CAS  PubMed  Google Scholar 

  13. Perramón M, Carvajal S, Reichenbach V, Fernández-Varo G, Boix L, Macias-Muñoz L, Melgar-Lesmes P, Bruix J, Melmed S, Lamas S, et al. The pituitary tumour-transforming gene 1/delta-like homologue 1 pathway plays a key role in liver fibrogenesis. Liver Int. 2022;42(3):651–62.

    Article  PubMed  PubMed Central  Google Scholar 

  14. Rodriguez P, Sassi Y, Troncone L, Benard L, Ishikawa K, Gordon RE, Lamas S, Laborda J, Hajjar RJ, Lebeche D. Deletion of delta-like 1 homologue accelerates fibroblast-myofibroblast differentiation and induces myocardial fibrosis. Eur Heart J. 2019;40(12):967–78.

    Article  CAS  PubMed  Google Scholar 

  15. Zeng N, Jian Z, Xu J, Zheng S, Fan Y, Xiao F. DLK1 overexpression improves sepsis-induced cardiac dysfunction and fibrosis in mice through the TGF-β1/Smad3 signaling pathway and MMPs. J Mol Histol. 2023;54(6):655–64.

    Article  CAS  PubMed  Google Scholar 

  16. Jensen CH, Johnsen RH, Eskildsen T, Baun C, Ellman DG, Fang S, Bak ST, Hvidsten S, Larsen LA, Rosager AM, et al. Pericardial delta like non-canonical NOTCH ligand 1 (Dlk1) augments fibrosis in the heart through epithelial to mesenchymal transition. Clin Transl Med. 2024;14(2): e1565.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  17. Cheng WH, Lee KY, Yu MC, Chen JY, Lin CH, Chen BC. Pref-1 induced lung fibroblast differentiation by hypoxia through integrin α5β1/ERK/AP-1 cascade. Eur J Pharmacol. 2021;909: 174385.

    Article  CAS  PubMed  Google Scholar 

  18. Liang J, Zhang Y, Xie T, Liu N, Chen H, Geng Y, Kurkciyan A, Mena JM, Stripp BR, Jiang D, et al. Hyaluronan and TLR4 promote surfactant-protein-C-positive alveolar progenitor cell renewal and prevent severe pulmonary fibrosis in mice. Nat Med. 2016;22(11):1285–93.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  19. Chen H, Matsumoto K, Brockway BL, Rackley CR, Liang J, Lee JH, Jiang D, Noble PW, Randell SH, Kim CF, et al. Airway epithelial progenitors are region specific and show differential responses to bleomycin-induced lung injury. Stem Cells. 2012;30(9):1948–60.

    Article  CAS  PubMed  Google Scholar 

  20. Little DR, Gerner-Mauro KN, Flodby P, Crandall ED, Borok Z, Akiyama H, Kimura S, Ostrin EJ, Chen J. Transcriptional control of lung alveolar type 1 cell development and maintenance by NK homeobox 2–1. Proc Natl Acad Sci U S A. 2019;116(41):20545–55.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  21. Vera L, Garcia-Olloqui P, Petri E, Viñado AC, Valera PS, Blasco-Iturri Z, Calvo IA, Cenzano I, Ruppert C, Zulueta JJ, et al. Notch3 Deficiency Attenuates Pulmonary Fibrosis and Impedes Lung-Function Decline. Am J Respir Cell Mol Biol. 2021;64(4):465–76.

    Article  CAS  PubMed  Google Scholar 

  22. Parimon T, Yao C, Stripp BR, Noble PW, Chen P. Alveolar Epithelial Type II Cells as Drivers of Lung Fibrosis in Idiopathic Pulmonary Fibrosis. Int J Mol Sci. 2020;21(7):2269.

  23. Conforti F, Ridley R, Brereton C, Alzetani A, Johnson B, Marshall BG, Fletcher SV, Ottensmeier CH, Richeldi L, Skipp P, et al. Paracrine SPARC signaling dysregulates alveolar epithelial barrier integrity and function in lung fibrosis. Cell Death Discov. 2020;6:54.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  24. Cattani-Cavalieri I, Valença SDS, Schmidt M. Nanodomains in cardiopulmonary disorders and the impact of air pollution. Biochem Soc Trans. 2020;48(3):799–811.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  25. Rock JR, Barkauskas CE, Cronce MJ, Xue Y, Harris JR, Liang J, Noble PW, Hogan BL. Multiple stromal populations contribute to pulmonary fibrosis without evidence for epithelial to mesenchymal transition. Proc Natl Acad Sci U S A. 2011;108(52):E1475–1483.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  26. Kong FE, Li GM, Tang YQ, Xi SY, Loong JHC, Li MM, Li HL, Cheng W, Zhu WJ, Mo JQ, et al. Targeting tumor lineage plasticity in hepatocellular carcinoma using an anti-CLDN6 antibody-drug conjugate. Sci Transl Med. 2021;13(579):eabb6282.

  27. Yu S, Zhang Y, Li Q, Zhang Z, Zhao G, Xu J. CLDN6 promotes tumor progression through the YAP1-snail1 axis in gastric cancer. Cell Death Dis. 2019;10(12):949.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  28. Zhou B, Flodby P, Luo J, Castillo DR, Liu Y, Yu FX, McConnell A, Varghese B, Li G, Chimge NO, et al. Claudin-18-mediated YAP activity regulates lung stem and progenitor cell homeostasis and tumorigenesis. J Clin Invest. 2018;128(3):970–84.

    Article  PubMed  PubMed Central  Google Scholar 

  29. Miyoshi K, Yanagi S, Kawahara K, Nishio M, Tsubouchi H, Imazu Y, Koshida R, Matsumoto N, Taguchi A, Yamashita S, et al. Epithelial Pten controls acute lung injury and fibrosis by regulating alveolar epithelial cell integrity. Am J Respir Crit Care Med. 2013;187(3):262–75.

    Article  CAS  PubMed  Google Scholar 

  30. Tiozzo C, De Langhe S, Yu M, Londhe VA, Carraro G, Li M, Li C, Xing Y, Anderson S, Borok Z, et al. Deletion of Pten expands lung epithelial progenitor pools and confers resistance to airway injury. Am J Respir Crit Care Med. 2009;180(8):701–12.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  31. Tiozzo C, Danopoulos S, Lavarreda-Pearce M, Baptista S, Varimezova R, Al Alam D, Warburton D, Virender R, De Langhe S, Di Cristofano A et al: Embryonic epithelial Pten deletion through Nkx2.1-cre leads to thyroid tumorigenesis in a strain-dependent manner. Endocr Relat Cancer 2012, 19(2):111–122.

  32. Chen QZ, Li Y, Shao Y, Zeng YH, Ren WY, Liu RX, Zhou LY, Hu XL, Huang M, He F, et al. TGF-β1/PTEN/PI3K signaling plays a critical role in the anti-proliferation effect of tetrandrine in human colon cancer cells. Int J Oncol. 2017;50(3):1011–21.

    Article  CAS  PubMed  Google Scholar 

  33. Grassi ES, Pietras A. Emerging Roles of DLK1 in the Stem Cell Niche and Cancer Stemness. J Histochem Cytochem. 2022;70(1):17–28.

    Article  CAS  PubMed  Google Scholar 

  34. López-Terrada D, Gunaratne PH, Adesina AM, Pulliam J, Hoang DM, Nguyen Y, Mistretta TA, Margolin J, Finegold MJ. Histologic subtypes of hepatoblastoma are characterized by differential canonical Wnt and Notch pathway activation in DLK+ precursors. Hum Pathol. 2009;40(6):783–94.

    Article  PubMed  Google Scholar 

  35. Luo JH, Ren B, Keryanov S, Tseng GC, Rao UN, Monga SP, Strom S, Demetris AJ, Nalesnik M, Yu YP, et al. Transcriptomic and genomic analysis of human hepatocellular carcinomas and hepatoblastomas. Hepatology. 2006;44(4):1012–24.

    Article  CAS  PubMed  Google Scholar 

  36. Araujo AN, Camacho CP, Mendes TB, Lindsey SC, Moraes L, Miyazawa M, Delcelo R, Pellegrino R, Mazzotti DR, Maciel RMB, et al. Comprehensive Assessment of Copy Number Alterations Uncovers Recurrent AIFM3 and DLK1 Copy Gain in Medullary Thyroid Carcinoma. Cancers (Basel). 2021;13(2):218.

  37. Grassi ES, Jeannot P, Pantazopoulou V, Berg TJ, Pietras A. Niche-derived soluble DLK1 promotes glioma growth. Neoplasia. 2020;22(12):689–701.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  38. Huang J, Zhang X, Zhang M, Zhu JD, Zhang YL, Lin Y, Wang KS, Qi XF, Zhang Q, Liu GZ, et al. Up-regulation of DLK1 as an imprinted gene could contribute to human hepatocellular carcinoma. Carcinogenesis. 2007;28(5):1094–103.

    Article  CAS  PubMed  Google Scholar 

  39. Takagi H, Zhao S, Muto S, Yokouchi H, Nishihara H, Harada T, Yamaguchi H, Mine H, Watanabe M, Ozaki Y, et al. Delta-like 1 homolog (DLK1) as a possible therapeutic target and its application to radioimmunotherapy using (125)I-labelled anti-DLK1 antibody in lung cancer models (HOT1801 and FIGHT004). Lung Cancer. 2021;153:134–42.

    Article  CAS  PubMed  Google Scholar 

  40. Crystal RG. Adenovirus: the first effective in vivo gene delivery vector. Hum Gene Ther. 2014;25(1):3–11.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  41. Li H, Malani N, Hamilton SR, Schlachterman A, Bussadori G, Edmonson SE, Shah R, Arruda VR, Mingozzi F, Wright JF, et al. Assessing the potential for AAV vector genotoxicity in a murine model. Blood. 2011;117(12):3311–9.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  42. Carneiro A, Lee H, Lin L, van Haasteren J, Schaffer DV. Novel Lung Tropic Adeno-Associated Virus Capsids for Therapeutic Gene Delivery. Hum Gene Ther. 2020;31(17–18):996–1009.

    Article  CAS  PubMed  Google Scholar 

  43. Sorroza-Martinez L, Pelletier M, Guay D, Gaillet B. Recent Advances in Therapeutics and Manufacturing Processes of Recombinant Adeno-Associated Virus for the Treatment of Lung Diseases. Curr Gene Ther. 2025;25(3):237–56.

  44. Beck SE, Jones LA, Chesnut K, Walsh SM, Reynolds TC, Carter BJ, Askin FB, Flotte TR, Guggino WB. Repeated delivery of adeno-associated virus vectors to the rabbit airway. J Virol. 1999;73(11):9446–55.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  45. Wagner JA, Messner AH, Moran ML, Daifuku R, Kouyama K, Desch JK, Manley S, Norbash AM, Conrad CK, Friborg S, et al. Safety and biological efficacy of an adeno-associated virus vector-cystic fibrosis transmembrane regulator (AAV-CFTR) in the cystic fibrosis maxillary sinus. Laryngoscope. 1999;109(2 Pt 1):266–74.

    Article  CAS  PubMed  Google Scholar 

  46. Moss RB, Rodman D, Spencer LT, Aitken ML, Zeitlin PL, Waltz D, Milla C, Brody AS, Clancy JP, Ramsey B, et al. Repeated adeno-associated virus serotype 2 aerosol-mediated cystic fibrosis transmembrane regulator gene transfer to the lungs of patients with cystic fibrosis: a multicenter, double-blind, placebo-controlled trial. Chest. 2004;125(2):509–21.

    Article  PubMed  Google Scholar 

  47. Moss RB, Milla C, Colombo J, Accurso F, Zeitlin PL, Clancy JP, Spencer LT, Pilewski J, Waltz DA, Dorkin HL, et al. Repeated aerosolized AAV-CFTR for treatment of cystic fibrosis: a randomized placebo-controlled phase 2B trial. Hum Gene Ther. 2007;18(8):726–32.

    Article  CAS  PubMed  Google Scholar 

  48. Maher TM. Interstitial Lung Disease: A Review. JAMA. 2024;331(19):1655–65.

    Article  CAS  PubMed  Google Scholar 

  49. Shariati S, Kalantar H, Pashmforoosh M, Mansouri E, Khodayar MJ. Epicatechin protective effects on bleomycin-induced pulmonary oxidative stress and fibrosis in mice. Biomed Pharmacother. 2019;114: 108776.

    Article  CAS  PubMed  Google Scholar 

  50. Della Latta V, Cecchettini A, Del Ry S, Morales MA. Bleomycin in the setting of lung fibrosis induction: From biological mechanisms to counteractions. Pharmacol Res. 2015;97:122–30.

    Article  CAS  PubMed  Google Scholar 

  51. Dong J. Signaling Pathways Implicated in Carbon Nanotube-Induced Lung Inflammation. Front Immunol. 2020;11: 552613.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  52. Lee JW, Chun W, Lee HJ, Min JH, Kim SM, Seo JY, Ahn KS, Oh SR. The Role of Macrophages in the Development of Acute and Chronic Inflammatory Lung Diseases. Cells. 2021;10(4):897.

  53. DiGiovanni GT, Han W, Sherrill TP, Taylor CJ, Nichols DS, Geis NM, Singha UK, Calvi CL, McCall AS, Dixon MM, et al. Epithelial Yap/Taz are required for functional alveolar regeneration following acute lung injury. JCI Insight. 2023;8(19):e173374.

  54. Abdelwahab EMM, Rapp J, Feller D, Csongei V, Pal S, Bartis D, Thickett DR, Pongracz JE. Wnt signaling regulates trans-differentiation of stem cell like type 2 alveolar epithelial cells to type 1 epithelial cells. Respir Res. 2019;20(1):204.

    Article  PubMed  PubMed Central  Google Scholar 

  55. Jain KG, Zhao R, Liu Y, Guo X, Yi G, Ji HL. Wnt5a/β-catenin axis is involved in the downregulation of AT2 lineage by PAI-1. Am J Physiol Lung Cell Mol Physiol. 2022;323(5):L515–l524.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  56. Frank DB, Peng T, Zepp JA, Snitow M, Vincent TL, Penkala IJ, Cui Z, Herriges MJ, Morley MP, Zhou S, et al. Emergence of a Wave of Wnt Signaling that Regulates Lung Alveologenesis by Controlling Epithelial Self-Renewal and Differentiation. Cell Rep. 2016;17(9):2312–25.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  57. Xu Y, Mizuno T, Sridharan A, Du Y, Guo M, Tang J, Wikenheiser-Brokamp KA, Perl AT, Funari VA, Gokey JJ, et al. Single-cell RNA sequencing identifies diverse roles of epithelial cells in idiopathic pulmonary fibrosis. JCI Insight. 2016;1(20): e90558.

    Article  PubMed  PubMed Central  Google Scholar 

  58. Hassan D, Chen J. CEBPA restricts alveolar type 2 cell plasticity during development and injury-repair. Nat Commun. 2024;15(1):4148.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  59. Jimenez FR, Lewis JB, Belgique ST, Wood TT, Reynolds PR. Developmental lung expression and transcriptional regulation of claudin-6 by TTF-1, Gata-6, and FoxA2. Respir Res. 2014;15(1):70.

    Article  PubMed  PubMed Central  Google Scholar 

  60. Qu H, Jin Q, Quan C. CLDN6: From Traditional Barrier Function to Emerging Roles in Cancers. Int J Mol Sci. 2021;22(24):13416.

  61. Riquelme SA, Hopkins BD, Wolfe AL, DiMango E, Kitur K, Parsons R, Prince A. Cystic Fibrosis Transmembrane Conductance Regulator Attaches Tumor Suppressor PTEN to the Membrane and Promotes Anti Pseudomonas aeruginosa Immunity. Immunity. 2017;47(6):1169–1181.e1167.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  62. Tian Y, Li H, Qiu T, Dai J, Zhang Y, Chen J, Cai H. Loss of PTEN induces lung fibrosis via alveolar epithelial cell senescence depending on NF-κB activation. Aging Cell. 2019;18(1): e12858.

    Article  PubMed  Google Scholar 

  63. Koziol-White C, Gebski E, Cao G, Panettieri RA Jr. Precision cut lung slices: an integrated ex vivo model for studying lung physiology, pharmacology, disease pathogenesis and drug discovery. Respir Res. 2024;25(1):231.

    Article  PubMed  PubMed Central  Google Scholar 

  64. Alsafadi HN, Uhl FE, Pineda RH, Bailey KE, Rojas M, Wagner DE, Königshoff M: Applications and Approaches for Three-Dimensional Precision-Cut Lung Slices. Disease Modeling and Drug Discovery. Am J Respir Cell Mol Biol 2020, 62(6):681–691.

  65. Alsafadi HN, Staab-Weijnitz CA, Lehmann M, Lindner M, Peschel B, Königshoff M, Wagner DE. An ex vivo model to induce early fibrosis-like changes in human precision-cut lung slices. Am J Physiol Lung Cell Mol Physiol. 2017;312(6):L896–l902.

    Article  PubMed  Google Scholar 

Download references

Acknowledgements

We thank all the healthy donors and IPF patients involved in our study. And appreciate Dr.Zhang Yuzhen for kindly providing the SPC-EGFP mice.

Clinical trial number

Not applicable.

Funding

This study was supported by the National Natural Science Foundation of China (Grant Nos. 82070073, 81670067 and 82003182) and Shanghai Pudong New Area Summit(emergency medicine and critical care) construction project(Grant No. PWYgf2021–03).

Author information

Author notes

  1. Yinzhen Li and Chen Zhou contributed equally to this work and share first authorship.

Authors and Affiliations

  1. Department of Emergency Medicine and Critical Care, School of Medicine, Shanghai East Hospital, Tongji University, Shanghai, 200092, China

    Yinzhen Li, Chunmei Wang & Jianwen Bai

  2. Research Center for Translational Medicine, School of Medicine, Shanghai East Hospital, Tongji University, Shanghai, 200092, China

    Yinzhen Li, Chen Zhou, Enhao Wang, Xuan Liu & Xiaohui Zhou

  3. Department of Respiratory and Critical Care Medicine, The Affiliated Hospital of Qingdao University, Qingdao, 266071, China

    Jiaxing Sun

  4. Shanghai Heart Failure Research Center, School of Medicine, Shanghai East Hospital, Tongji University, Shanghai, 200092, China

    Xuan Liu & Xiaohui Zhou

Authors
  1. Yinzhen Li
    View author publications

    You can also search for this author inPubMed Google Scholar

  2. Chen Zhou
    View author publications

    You can also search for this author inPubMed Google Scholar

  3. Jiaxing Sun
    View author publications

    You can also search for this author inPubMed Google Scholar

  4. Enhao Wang
    View author publications

    You can also search for this author inPubMed Google Scholar

  5. Chunmei Wang
    View author publications

    You can also search for this author inPubMed Google Scholar

  6. Xuan Liu
    View author publications

    You can also search for this author inPubMed Google Scholar

  7. Xiaohui Zhou
    View author publications

    You can also search for this author inPubMed Google Scholar

  8. Jianwen Bai
    View author publications

    You can also search for this author inPubMed Google Scholar

Contributions

Yinzhen Li and Chen Zhou did the most investigation and writing the original manuscripts as well as this revision. Jiaxing Sun did the perspective and conclusion parts. Enhao Wang and Chunmei Wang did the data analysis. Xuan Liu did the background research. Xiaohui Zhou guided the direction of the experiment and revision of manuscript. Jianwen Bai participated in the conceptualization, supervision, and funding. All authors have read and agreed to the published version of the manuscript.

Corresponding authors

Correspondence to Xiaohui Zhou or Jianwen Bai.

Ethics declarations

Ethics approval and consent to participate

This study was approved by the Ethics Committee of The Affiliated Hospital of Qingdao University (QYFY WZLL 27659), and informed consent was obtained from each patient. All experiments were performed following relevant guidelines and regulations. The animal study protocol was approved by the Institutional Animal Care and Use Committee of Tongji University (Number: TJBB00122107), and they were performed following ethical guidelines.

Consent for publication

Not Applicable.

Competing interests

The authors declare no competing interests.

Additional information

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Li, Y., Zhou, C., Sun, J. et al. Inhibition of DLK1 regulates AT2 differentiation and alleviates established pulmonary fibrosis by upregulating TTF-1/CLDN6. Respir Res 26, 188 (2025). https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s12931-025-03264-z

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s12931-025-03264-z

Keywords

Respiratory Research

ISSN: 1465-993X

Contact us